Escherichia coli and community-acquired gastroenteritis, Melbourne, Australia

Emerging Infectious Diseases, Oct, 2004 by Roy M. Robins-Browne, Anne-Marie Bordun, Marija Tauschek, Vicki R. Bennett-Wood, Jacinta Russell, Frances Oppedisano, Nicole A. Lister, Karl A. Bettelheim, Christopher K. Fairley, Martha I. Sinclair, Margaret E. Hellard

Table 1. Characteristics of the polymerase chain reaction (PCR)
primers used to detect pathogenic Escherichia coli in mixed culture

Target gene
or virulence
factor        Primer (a)   Primer sequence (5' to 3')

              [1.sup.1]       GACCCGGCACAAGCATAAGC
eae           [2.sup.1]       CCACCTGCAGCAACAAGAGG

              [1.sup.1]       GCATCATCAAGCGTACGTTCC
ehxA          [2.sup.1]      AATGAGCCAAGCTGGTTAAGCT

              [1.sup.2]      ATAAATCGCCATTCGTTGACTAC
stx1          [2.sup.2]       AGAACGCCCACTGAGATCATC

              [1.sup.2]       GGCACTGTCTGAAACTGCTCC
stx2          [2.sup.2]      TCGCCAGTTATCTGACATTCTG

              [1.sup.3]       GGCGACAGATTATACCGTGC
ltA           [2.sup.3]       CCGAATTCTGTTATATATGTC

              [1.sup.3]       TCTGTATTATCTTTCCCCTC
st1A          [2.sup.3]        ATAACATCCAGCACAGGC

              1               CAGCAGATTGCAGCGCATAT
ipaC          2               CAAGAGCAGATGCATAACGC

              1                ATTGAATCTGCAATGGTGC
bfpA          2               ATAGCAGTCGATTTAGCAGCC

              1               CTGGCGAAAGACTGTATCAT
pCVD432       2              CAATGTATAGAAATCCGCTGTT

              1               ATGCATTACTTTGGGTTTAG
aggA          2                TCAACCTTGACACTTGCC

              1               TGATTGAAGCAGAAGCCTGC
lacZ          2               CGCCAATCCACATCTGTGAA

Target gene
or virulence
factor        Primer (a)   PCR program (30 cycles) (b)

              [1.sup.1]        95[degrees]C, 30 s;
eae           [2.sup.1]        54[degrees]C, 90 s;
                               72[degrees]C, 90 s

              [1.sup.1]
ehxA          [2.sup.1]

              [1.sup.2]        95[degrees]C, 30 s;
stx1          [2.sup.2]        52[degrees]C, 60 s;
                             72[degrees]C, 60 s (c)

              [1.sup.2]
stx2          [2.sup.2]

              [1.sup.3]        94[degrees]C, 60 s;
ltA           [2.sup.3]        50[degrees]C, 60 s;
                             72[degrees]C, 120 s (c)

              [1.sup.3]
st1A          [2.sup.3]

              1                94[degrees]C, 30 s;
ipaC          2                59[degrees]C, 90 s;
                               72[degrees]C, 90 s

              1                95[degrees]C, 40 s;
bfpA          2                55[degrees]C, 40 s;
                               72[degrees]C, 40 s

              1                94[degrees]C, 40 s;
pCVD432       2                53[degrees]C, 60 s;
                               72[degrees]C, 60 s

              1                94[degrees]C, 60 s;
aggA          2                50[degrees]C, 60 s;
                             72[degrees]C, 120 s (c)

              1                94[degrees]C, 30 s;
lacZ          2                59[degrees]C, 90 s;
                               72[degrees]C, 90 s

Target gene
or virulence                         Product
factor        Primer (a)            size (bp)            Reference

              [1.sup.1]               384                   (8)
eae           [2.sup.1]

              [1.sup.1]               534                   (8)
ehxA          [2.sup.1]

              [1.sup.2]               180                   (8)
stx1          [2.sup.2]

              [1.sup.2]               255                   (8)
stx2          [2.sup.2]

              [1.sup.3]               696                   (9)
ltA           [2.sup.3]

              [1.sup.3]               186                   (9)
st1A          [2.sup.3]

              1                       811                This study
ipaC          2

              1                       461                This study
bfpA          2

              1                       630                   (10)
pCVD432       2

              1                       414                This study
aggA          2

              1                      1,350               This study
lacZ          2

(a) Primers with the same superscript were used in duplex PCRs.

(b) Before the first cycle, the sample was denatured for 10 min
at 95[degrees]C; after the last cycle, the sample was extended
for 8 min at 72[degrees]C.

(c) 35 cycles.

Table 2. Classification of pathogenic Escherichia coli according
to amplicon(s) generated by polymerase chain reaction for
virulence-associated determinants

                     Gene or virulence-associated determinant (a)

Interpretation (b)   pCVD432     aggA      bfpA      eae     exhA

EAEC (c)                                     -        -        -
Typical EPEC            -          -                           -
Atypical EPEC           -          -         -                 -
EIEC                    -          -         -        -        -
ETEC (c)                -          -         -        -        -
EHEC (d)                -          -         -                  
STEC, not EHEC (e)      -          -         -        -        -

                      Gene or virulence-associated determinant (a)

Interpretation (b)    ipaC       stlA       ltA     stx1     stx2

EAEC (c)                -          -         -        -        -
Typical EPEC            -          -         -        -        -
Atypical EPEC           -          -         -        -        -
EIEC                               -         -        -        -
ETEC (c)                -                             -        -
EHEC (d)                -          -         -                  
STEC, not EHEC (e)      -          -         -                  

                     Control
Interpretation (b)   strain    Reference

EAEC (c)               O42       (11)
Typical EPEC        E2348/69     (12)
Atypical EPEC        E128012     (12)
EIEC                 223/83      (13)
ETEC (c)             H10407      (14)
EHEC (d)             EDL933      (15)
STEC, not EHEC (e)

(a) Factors specified by virulence genes: aggA, aggregative
fimbria, AAF/I; bfpA, bundle-forming pilus; eae, intimin;
ipaC, invasion plasmid antigen; stlA, heat-stable enterotoxin;
ltA, heat-labile enterotoxin; stx, Shiga toxin.

(b) EAEC, enteroaggregative E. coli; EPEC, enteropathogenic E.
coli, EIEC, enteroinvasive E. coli; ETEC, enterotoxigenic E. coli;
STEC, Shiga toxin-producing E. coli; EHEC, enterohemorrhagic E. coli.

(c) Either stlA or ltA positive.

(d) Either eae or ehxA and stx1 or stx2 positive.

(e) Either stx1 or stx2 positive.

Table 3. Characteristics of the polymerase chain reaction
(PCR) primers used in this study for strain characterization

                                                        PCR program
Primer      Primer sequence (5' to 3')   Target       (30 cycles) (a)

P1 (b)         CTGAACGGCGATTACGCGAA

P2              CCAGACGATACGATCCAG       eae (c)    94[degrees]C, 30 s,
                                                    53[degrees]C, 30 s;
                                                     72[degrees]C, 60 s

P3              CTGGAGTTGTCGATGTT         eae-      94[degrees]C, 30 s;
                                         [alpha]    53[degrees]C, 30 s;
                                                    72[degrees]C, 120 s

P4               GTAATTGTGGCACTCC         eae-      94[degrees]C, 30 s;
                                         [beta]     53[degrees]C, 30 s;
                                                    72[degrees]C, 120 s

P5              GCCTCTGACATTGTTAC         eae-      94[degrees]C, 30 s;
                                         [gamma]    53[degrees]C, 30 s;
                                                    72[degrees]C, 120 s

ecsD-lower    TATTTTCAAAAAGAATGATGTC       eae      94[degrees]C, 30 s;
                                                    53[degrees]C, 30 s;
                                                    72[degrees]C, 150 s

SKl (e)      CCCGAATTCGGCACAAGCATAAGC

LP5         AGCTCACTCGTAGATGACGGCAAGCG    eae-      94[degrees]C, 30 s,
                                        [epsilon]   53[degrees]C, 60 s;
                                                    72[degrees]C, 120 s

LP6B           TAGTTGTACTCCCCTTATCC       eae-      94[degrees]C, 30 s;
                                         [zeta]     53[degrees]C, 60 s;
                                                    72[degrees]C, 150 s

LP7            TTTATCCTGCTCCGTTTGCT       eae-      94[degrees]C, 30 s;
                                         [iota]     53[degrees]C, 60 s;
                                                    72[degrees]C, 150 s

LP8             TAGATGACGGTAAGCGAC      eae-[eta]   94[degrees]C, 30 s;
                                                    53[degrees]C, 60 s;
                                                    72[degrees]C, 150 s

LP10           GGCATTGTTATCTGTTGTCT       eae-      94[degrees]C, 30 s;
                                         [kappa]    53[degrees]C, 60 s;
                                                    72[degrees]C, 150 s

LP11B         GTTGATAACTCCTGATATTTTA      eae-      94[degrees]C, 30 s;
                                         [theta]    53[degrees]C, 60 s;
                                                    72[degrees]C, 150 s

LPFDF           GAACTGTAGATGGGTAC         lpfD      94[degrees]C, 30 s;
LPFDR           AGCAGGCATAACGCAAG                   53[degrees]C, 50 s;
                                                     72[degrees]C, 60 s

Donne-280     CGGAACAGTAGGTTCACCTTC       efa1      94[degrees]C, 30 s,
Donne-281     AGTGCCCGTGTTCTTGAACTG                 50[degrees]C, 30 s;
                                                    72[degrees]C, 120 s

EASTOS1       GCCATCAACACAGTATATCCG       astA      94[degrees]C, 30 s,
EASTOS2        CGCGAGTGACGGCTTTGTAG                 50[degrees]C, 60 s;
                                                     72[degrees]C, 90 s

AggRksl       GTATACACAAAAGAAGGAAGC       aggR      94[degrees]C, 30 s,
AggRkas2       ACAGAATCGTCAGCATCAGC                 50[degrees]C, 60 s;
                                                    72[degrees]C, 45 s
                                                              (f)

                                            Product
Primer      Primer sequence (5' to 3')     size (bp)      Reference

P1 (b)         CTGAACGGCGATTACGCGAA

P2              CCAGACGATACGATCCAG           917             (17)

P3              CTGGAGTTGTCGATGTT           1,648            (17)

P4               GTAATTGTGGCACTCC           1,926            (17)

P5              GCCTCTGACATTGTTAC           1,770            (17)

ecsD-lower    TATTTTCAAAAAGAATGATGTC    [approximately       (18)
                                        equal to] 2,990
                                              (d)

SKl (e)      CCCGAATTCGGCACAAGCATAAGC

LP5         AGCTCACTCGTAGATGACGGCAAGCG      2,608            (18)

LP6B           TAGTTGTACTCCCCTTATCC         2,430            (18)

LP7            TTTATCCTGCTCCGTTTGCT         2,685            (18)

LP8             TAGATGACGGTAAGCGAC          2,590            (18)

LP10           GGCATTGTTATCTGTTGTCT         2,769            (18)

LP11B         GTTGATAACTCCTGATATTTTA        2,686            (18)

LPFDF           GAACTGTAGATGGGTAC            798             (19)
LPFDR           AGCAGGCATAACGCAAG

Donne-280     CGGAACAGTAGGTTCACCTTC         2,226            (20)
Donne-281     AGTGCCCGTGTTCTTGAACTG

EASTOS1       GCCATCAACACAGTATATCCG          109             (10)
EASTOS2        CGCGAGTGACGGCTTTGTAG

AggRksl       GTATACACAAAAGAAGGAAGC          254             (21)
AggRkas2       ACAGAATCGTCAGCATCAGC

(a) Before the first cycle, the sample was denatured for 10 min at
95[degrees]C; after the last cycle, the sample was extended for 7
min at 72[degrees]C.

(b) Primer P1 was used as forward primer in all PCR reactions in
combination with P2, P3, P4, and escD-lower.

(c) Conserved region of eae.

(d) Amplicon sequenced.

(e) Primer SK1 was used as forward primer in all PCR reactions
in combination with LP5, LP68, LP7, LP8, LP10, and LP11 B.

(f) 35 cycles.

Table 4. Frequency of Escherichia coli pathotypes in
study participants with and without gastroenteritis

                                   Source

                        Symptomatic   Symptom-free
E. coli pathotype (a)  (n = 696) (%)  (n = 489) (%)  p (b)

EAEC                     45 (6.5)       15 (3.1)      0.02
Typical EPEC              2 (0.3)        1 (0.2)      NS
Atypical EPEC            89 (12.8)      11 (2.3)     <0.0001
EIEC                         0              0         NS
ETEC                      2 (0.3)           0         NS
EHEC                      4 (0.6)           0         NS
STEC not EHEC                0           1 (0.2)      NS

(a) EAEC, enteroaggregative E. coli; EPEC, enteropathogenic E. coli;
EIEC, enteroinvasive E. coli; ETEC, enterotoxigenic E. coli; STEC,
Shiga toxin-producing E. coli, EHEC, enterohemorrhagic E. coli;
NS, not significant (p > 0.1).

(b) Fisher exact test, 2-tailed.

Table 5. Characteristics of 22 isolates of atypical
enteropathogenic Escherichia coli identified during
this study

                                         Intimin
Strain     Sources       Serotype         type

W7            N          0161:H40        [beta]
W85-2         N           OR:H-          [gamma]
W114          N          0107:H8         [iota]
W143          N           Ont:H5        [epsilon]
W145          N           055:H6         [gamma]
W154          N          0139:H14        [beta]
W185          N          Ont:H21         [theta]
W208          N           Ont:H4         [beta]
W761          N          0124:H40       [lambda]
W902          N          0125:H6        [alpha]2
W914          N          0125:H6         [alpha]
W1040         G          015:Hnt         [beta]
W1056         G           055:H7         [gamma]
W1068         G          051:H49         [alpha]
W1082         G           Ont:H6         [beta]
W1092         G           OR:H-      [eta]/[epsilon]
W1108         G          0172:H4         [theta]
W1118         G          0126:H6         [alpha]
W1120         G          Ont:H34         [alpha]
W1134         G           Ont:H6         [theta]
W1585         G          Ont:H40         [theta]
W1706         G           Ont:H6         [alpha]
E128012       C          0114:H2         [beta]

                        Result of PCR (b)

Strain       bfpA     aggR     efa1     astA  lpfD

W7            -        -         -       -     -
W85-2         -        -         -       -     -
W114          -        -         -       -     -
W143          -        -         -       -     -
W145          -        -                       -
W154          -        -         -       -     -
W185          -        -         -       -     -
W208          -        -         -       -     -
W761          -        -         -       -     -
W902          -        -         -       -     -
W914          -        -         -       -     -
W1040         -        -                 -      
W1056         -        -                       -
W1068         -        -         -       -     -
W1082         -        -         -       -     -
W1092         -        -         -       -      
W1108         -        -         -       -     -
W1118         -        -         -       -     -
W1120         -        -         -       -     -
W1134         -        -         -       -     -
W1585         -        -         -       -     -
W1706         -        -         -       -     -
E128012       -        -                 -      

           Adhesion        FAS         HEp-2 cell
Strain   pattern (a)      assay       invasion (c)

W7            NA            -             0.01
W85-2         AA                          0.02
W114          IA                          0.02
W143          IA                         <0.01
W145          AA                          0.03
W154          AA                         <0.01
W185          IA                          0.02
W208          IA                          0.08
W761          NA            -             0.07
W902          IA                          0.06
W914          AA                          0.07
W1040        LAL                          0.10
W1056         IA                          0.77
W1068         AA                         <0.01
W1082         AA                          0.01
W1092         IA                         <0.01
W1108         IA                          0.03
W1118         IA                          0.01
W1120         IA                          0.01
W1134         NA            -             0.01
W1585         NA            -             0.02
W1706         AA                          0.01
E128012       IA                          0.32

(a) N, no symptoms; G, gastroenteritis; C, control strain;
Ont, O nontypable (O1-O181); Hnt, H nontypable (H1-H56);
NA, nonadherent; AA, aggregative adherence pattern; IA,
indeterminate adherence pattern; LAL, localized-like
adherence pattern; FAS, fluorescent actin staining.

(b) PCR, polymerase chain reaction;  , positive; -, negative.

(c) Data are the number of bacteria recovered from HEp-2 cells
after treatment with gentamicin as a percentage of the total
number of cell-associated bacteria and are the mean of two
separate assays.

 

BNET TalkbackShare your ideas and expertise on this topic

Please add your comment:

  1. You are currently: a Guest |
  2.  

Basic HTML tags that work in comments are: bold (<b></b>), italic (<i></i>), underline (<u></u>), and hyperlink (<a href></a)

advertisement
Click Here
advertisement
  • Click Here
  • Click Here
  • Click Here
advertisement

Content provided in partnership with Thompson Gale